GA20, GA20 (genetic_marker) Cicer arietinum

Marker Overview
NameGA20
Genbank IDN/A
TypeSTMS
SpeciesCicer arietinum
GermplasmILC3279
Repeat Motif(CT)23
Primer 1GA20.Forward primer: TATGCACCACACCTCGTACC
Primer 2GA20.Reverse primer: TGACGGAATTCGTGATGTGT
Product Length174
Publication[view all]
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward primerGA20.Forward primerCicer arietinumprimer
Reverse primerGA20.Reverse primerCicer arietinumprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
Ascochyta blight resistanceqABR.P1359075xFLIP84-92C.LG2A6BCicer arietinumQTL
Ascochyta blight resistanceqABR.P1359075xFLIP84-92C.LG2A6B.2Cicer arietinumQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
GA20GA20Cicer arietinummarker_locus


Germplasm
Stock NameType
ILC3279breeding_research_material