GA20, GA20 (genetic_marker) Cicer arietinum

Name	GA20
Genbank ID	N/A
Type	STMS
Species	Cicer arietinum
Germplasm	ILC3279
Repeat Motif	(CT)23
Primer 1	GA20.Forward primer: TATGCACCACACCTCGTACC
Primer 2	GA20.Reverse primer: TGACGGAATTCGTGATGTGT
Product Length	174
Publication	[view all]

Aligned Feature	Feature Type	Alignment Location
Ca2	chromosome	Ca2:34747581..34747748 .
chr2	chromosome	chr2:34747581..34747748 .

Year	Publication
1999	Winter P, Pfaff T, Udupa SM, Huttel B, Sharma PC, Sahi S, Arrequin-Espinoza R, Weigand F, Muehlbauer FJ, Kahl G. Characterization and mapping of sequence-tagged microsatellite sites in the chickpea (Cicer arietinum L.) genome. Mol Gen Genet. 1999; 262:90-101.
2013	Sabbavarapu MM, Sharma M, Chamarthi SK, Swapna N, Rathore A, Thudi M, Gaur PM, Pande S, Singh S, Kaur L, Varshney RK. Molecular mapping of QTLs for resistance to Fusarium wilt (race 1) and Ascochyta blight in chickpea (Cicer arietinum L.). Euphytica. 2013; 193(1):121-133.

Stock Name	Type
ILC3279	accession

#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	chickpea-C214xILC3279-F2	LG2	N/A	0	GA20	View
2	chickpea-ICC4991xICCV04516-F2	LG2	N/A	39.3	GA20	View
3	chickpea-ICCV96029xCDCCorinne-F2	LG2	N/A	0	GA20	View
4	chickpea-ICCV96029xCDCFrontier-F2	LG2	N/A	18.2	GA20	View
5	chickpea-ILC3279xICCV2-F3	LG2	N/A	6	GA20	View
6	chickpea-ICCV96029xCDCFrontier-F2-2007	LG2	N/A	18.2	GA20	View
7	chickpea-HadasxCr205-F2	LG2B	N/A	0	GA20	View
8	chickpea-ILC588xILC3279-RIL-F6	LG2	N/A	0.6	GA20	View
9	Chickpea-ICCL81001_x_Cr5-9-RIL	LG2	N/A	98.6	GA20	View
10	Chickpea-ICC4958× ICC1882-RIL	CaLG02	N/A	92.16	GA20	View
11	Chickpea-RIP12-Ortega	LG02	N/A	25.7	GA20	View
12	Chickpea-RIP5-Ortega	LG02	N/A	0	GA20	View
13	Chickpea-RIP8-Ortega	LG02-1	N/A	28.2	GA20	View