GAA41, GAA41 (genetic_marker) Cicer arietinum | PulseDB

Marker Overview

Marker Overview


Name	GAA41
Genbank ID	N/A
Type	STMS
Species	Cicer arietinum
Germplasm	ILC3279
Repeat Motif	(GAA)10
Primer 1	GAA41.Forward primer: TATTCCATCATGCCAGCAAA
Primer 2	GAA41.Reverse primer: ATAGGGCAGAAACTGGAGCA
Product Length	182
Publication	[view all]

Publications


Year	Publication
1999	Winter P, Pfaff T, Udupa SM, Huttel B, Sharma PC, Sahi S, Arrequin-Espinoza R, Weigand F, Muehlbauer FJ, Kahl G. Characterization and mapping of sequence-tagged microsatellite sites in the chickpea (Cicer arietinum L.) genome. Mol Gen Genet. 1999; 262:90-101.

Germplasm


Stock Name	Type
ILC3279	accession

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	chickpea-ICC4958xPI489777-RIL-2012	LG6	N/A	101.4	GAA41	View
2	chickpea-ICC4958xPI489777-RIL-2012-2	LG6	N/A	126.5	GAA41	View
3	chickpea-ICC4958xPI489777-RIL-2010	LG6	N/A	276.5	GAA41	View
4	chickpea-ICC4958xPI489777-RIL-2015-2	LG6	N/A	61.7	GAA41	View
5	Chickpea-ICC4958/PI489777-RIL-2020	LG06	N/A	165.13	GAA41	View