GAA46, GAA46 (genetic_marker) Cicer arietinum | PulseDB

Marker Overview

Marker Overview


Name	GAA46
Genbank ID	N/A
Type	STMS
Species	Cicer arietinum
Germplasm	ILC3279
Repeat Motif	(GAA)3(A)3(GAA)8
Primer 1	GAA46.Forward primer: TCTCCTGTGAATGAACCGAA
Primer 2	GAA46.Reverse primer: CTGAGCAACAAAATCAGCCA
Product Length	195
Publication	[view all]

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
C11176802	supercontig	C11176802:3015..3209 .

Publications


Year	Publication
1999	Winter P, Pfaff T, Udupa SM, Huttel B, Sharma PC, Sahi S, Arrequin-Espinoza R, Weigand F, Muehlbauer FJ, Kahl G. Characterization and mapping of sequence-tagged microsatellite sites in the chickpea (Cicer arietinum L.) genome. Mol Gen Genet. 1999; 262:90-101.

Germplasm


Stock Name	Type
ILC3279	accession

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	chickpea-ICC4958xPI489777-RIL-2012	LG3	N/A	126.9	GAA46	View
2	chickpea-ICC4958xPI489777-RIL-2012-2	LG8	N/A	44.2	GAA46	View
3	chickpea-ICC4958xPI489777-RIL-F10	LG8	N/A	8.82	GAA46	View
4	chickpea-HadasxCr205-F2	LG8B	N/A	0	GAA46	View
5	chickpea-ICC3996xILWC184-F2	LG8	N/A	0	GAA46	View
6	chickpea-ICC4958xPI489777-RIL-2010	LG8	N/A	21.7	GAA46	View
7	chickpea-ICC4958xPI489777-RIL-2015-2	LG8	N/A	31.1	GAA46	View
8	Chickpea-ICC4958/PI489777-RIL-2020	LG08	N/A	163.37	GAA46	View