GAA60, GAA60 (genetic_marker) Cicer arietinum | PulseDB

Marker Overview

Marker Overview


Name	GAA60
Genbank ID	N/A
Type	STMS
Species	Cicer arietinum
Germplasm	ILC3279
Repeat Motif	(TTA)35(ATT)28
Primer 1	GAA60.Forward primer: TTGGTTTGCAAATTGTTCTTC
Primer 2	GAA60.Reverse primer: AAGTCCATTGAAGTGTCGCC
Product Length	350
Publication	[view all]

Publications


Year	Publication
1999	Winter P, Pfaff T, Udupa SM, Huttel B, Sharma PC, Sahi S, Arrequin-Espinoza R, Weigand F, Muehlbauer FJ, Kahl G. Characterization and mapping of sequence-tagged microsatellite sites in the chickpea (Cicer arietinum L.) genome. Mol Gen Genet. 1999; 262:90-101.

Germplasm


Stock Name	Type
ILC3279	accession

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	chickpea-ICC4958xPI489777-RIL-2012	LG7	N/A	166.5	GAA60	View
2	chickpea-ICC4958xPI489777-RIL-2012-2	LG8	N/A	143.2	GAA60	View
3	chickpea-ICC4958xPI489777-RIL-F10	LG7	N/A	133.98	GAA60	View
4	chickpea-ICC4958xPI489777-RIL-2015-2	LG2	N/A	22.71	GAA60	View
5	Chickpea-ICC4958/PI489777-RIL-2020	LG02	N/A	20.95	GAA60	View