H1B06, H1B06 (genetic_marker) Cicer arietinum

Marker Overview
NameH1B06
Genbank IDN/A
TypeSSR
SpeciesCicer arietinum
GermplasmHadas
Repeat Motif(TTA)28
Primer 1H1B06.Forward primer: GACTCACTCTCCAAATGGAACC
Primer 2H1B06.Reverse primer: AAGCCCATGAAAACCATATATTC
Product Length197
Publication[view all]
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward primerH1B06.Forward primerCicer arietinumprimer
Reverse primerH1B06.Reverse primerCicer arietinumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
H1B06H1B06Cicer arietinummarker_locus


Germplasm
Stock NameType
Hadascultivar
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1chickpea-ICCV96029xCDCCorinne-F2LG2N/A69.2H1B06View
2chickpea-ICCV96029xCDCFrontier-F2LG2N/A137.5H1B06View
3chickpea-ICCV96029xCDCLuna-F2LG2N/A30.2H1B06View
4chickpea-ICCV2xJG62-RIL-F10-2011LGIIN/A48.8H1B06View
5chickpea-ICCV96029xCDCFrontier-F2-2007LG2N/A137.5H1B06View
6chickpea-HadasxICC5810-RILLG2N/A61H1B06View
7Chickpea-RIP5-OrtegaLG02N/A23H1B06View
8Chickpea-RIP8-OrtegaLG02-1N/A2.7H1B06View