H1C092, H1C092 (genetic_marker) Cicer arietinum | PulseDB

Marker Overview

Marker Overview


Name	H1C092
Genbank ID	N/A
Type	SSR
Species	Cicer arietinum
Germplasm	Hadas
Repeat Motif	(GAA)5 119 bp (TAA)29
Primer 1	H1C092.Forward primer: CAATAAAACACTTTGTTCCTTTTT
Primer 2	H1C092.Reverse primer: TGTAGAAAGAAAGCTAGCATGG
Product Length	242
Publication	[view all]

Publications


Year	Publication
2005	Lichtenzveig J, Scheuring C, Dodge J, Abbo S, Zhang HB. Construction of BAC and BIBAC libraries and their applications for generation of SSR markers for genome analysis of chickpea, Cicer arietinum L. TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2005 Feb; 110(3):492-510.

Germplasm


Stock Name	Type
Hadas	accession

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	chickpea-ICC4958xPI489777-RIL-2011	LG8	N/A	53	H1C092	View
2	chickpea-ICCV2xJG62-RIL-F10-2011	LGVIII	N/A	11.1	H1C092	View
3	chickpea-ICC4958xPI489777-RIL-F10	LG8	N/A	55.11	H1C092	View
4	chickpea-Hadas-2010	LG8	N/A	0	H1C092	View
5	chickpea-HadasxICC5810-RIL	LG8	N/A	0	H1C092	View
6	chickpea-ICC4958xPI489777-RIL-F10-2012	LG08	N/A	52.4	H1C092	View
7	chickpea-ICC3996xILWC184-F2	LG8	N/A	41.8	H1C092	View
8	chickpea-ICC4958xPI489777-RIL-2010	LG8	N/A	108.2	H1C092	View
9	chickpea-ICCV96029×CDCFrontier-F2-2017	CaLG08	N/A	44.4	H1C092	View
10	chickpea-flowering_time_consensus_map-F2-2017	CaLG08	N/A	29.2	H1C092	View
11	Chickpea-JG62/ICCV05530-RIL	LG08	N/A	23.72	H1C092	View