H1F05, H1F05 (genetic_marker) Cicer arietinum

Marker Overview
NameH1F05
Genbank IDN/A
TypeSSR
SpeciesCicer arietinum
GermplasmHadas
Repeat Motif(TAA)36
Primer 1H1F05.Forward primer: ATAACTCAAATCGTTTCACAAGA
Primer 2H1F05.Reverse primer: AAACCCCTTTTTATTTTCAATTT
Product Length173
Publication[view all]
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward primerH1F05.Forward primerCicer arietinumprimer
Reverse primerH1F05.Reverse primerCicer arietinumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
H1F05H1F05Cicer arietinummarker_locus


Germplasm
Stock NameType
Hadascultivar
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1chickpea-C214xWR315-F2LG2N/A60.7H1F05View
2chickpea-ICC4958xPI489777-RIL-2011LG2N/A59.3H1F05View
3chickpea-ICCV2xJG62-RIL-F10-2011LGIIN/A0H1F05View
4chickpea-ICC4958xPI489777-RIL-F10LG2N/A52.07H1F05View
5chickpea-HadasxICC5810-RILLG2N/A23.6H1F05View
6chickpea-ICC4958xPI489777-RIL-F10-2012LG02N/A51.08H1F05View
7chickpea-ICC4958xPI489777-RIL-2010LG2N/A126.4H1F05View
8Chickpea-RIP5-OrtegaLG02N/A12.4H1F05View
9Chickpea-RIP8-OrtegaLG02-1N/A14H1F05View