H1P02, H1P02 (genetic_marker) Cicer arietinum

Name	H1P02
Genbank ID	N/A
Type	SSR
Species	Cicer arietinum
Germplasm	Hadas
Repeat Motif	(GAA)5
Primer 1	H1P02.Forward primer: AAGAGGAAAGCTCCTCCAAC
Primer 2	H1P02.Reverse primer: TCTTCAACAGGTTTGCCTTT
Product Length	128
Publication	[view all]

Year	Publication
2005	Lichtenzveig J, Scheuring C, Dodge J, Abbo S, Zhang HB. Construction of BAC and BIBAC libraries and their applications for generation of SSR markers for genome analysis of chickpea, Cicer arietinum L. TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2005 Feb; 110(3):492-510.

Stock Name	Type
Hadas	accession