H1P091, H1P091 (genetic_marker) Cicer arietinum

Name	H1P091
Genbank ID	N/A
Type	SSR
Species	Cicer arietinum
Germplasm	Hadas
Repeat Motif	(GAA)6 61 bp (TTA)16 TCA(TTA)22TTG(TTA)5
Primer 1	H1P091.Forward primer: GTCTCGGTTTTGCATGACAC
Primer 2	H1P091.Reverse primer: GGAACACCGGTTCCCATC
Product Length	146
Publication	[view all]

Year	Publication
2005	Lichtenzveig J, Scheuring C, Dodge J, Abbo S, Zhang HB. Construction of BAC and BIBAC libraries and their applications for generation of SSR markers for genome analysis of chickpea, Cicer arietinum L. TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2005 Feb; 110(3):492-510.

Stock Name	Type
Hadas	accession

#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	chickpea-ICCV2xJG62-RIL-F10-2011	LGVII	N/A	0	H1P091	View