H2I20, H2I20 (genetic_marker) Cicer arietinum

Marker Overview
NameH2I20
Genbank IDN/A
TypeSSR
SpeciesCicer arietinum
GermplasmHadas
Repeat Motif(TTA)13 CTA (TTA)19
Primer 1H2I20.Forward primer: TGTTTTGCTCATCTGTTAAATCAA
Primer 2H2I20.Reverse primer: AGCATGCCTCTGATGAATAGTAAC
Product Length190
Publication[view all]
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward primerH2I20.Forward primerCicer arietinumprimer
Reverse primerH2I20.Reverse primerCicer arietinumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
H2I20H2I20Cicer arietinummarker_locus


Germplasm
Stock NameType
Hadascultivar
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1chickpea-ICCV2xJG62-RIL-F10-2011LGVN/A37.5H2I20View
2Chickpea-CA2156_x_JG62-RILRIP-1 LG5N/A27.2H2I20View
3Chickpea-ILC3279_x_JG62-RILRIP-7 LG5N/A8.9H2I20View
4Chickpea-JG62_x_ILC72-RILRIP-10 LG5N/A23.2H2I20View
5Chickpea-Physical_consensusCa5N/A15797986H2I20View