H3C06, H3C06 (genetic_marker) Cicer arietinum

Marker Overview
NameH3C06
Genbank IDN/A
TypeSSR
SpeciesCicer arietinum
GermplasmHadas
Repeat Motif(TAA)23
Primer 1H3C06.Forward primer: AATTTCGTGAATCATTAAAAATAGAGG
Primer 2H3C06.Reverse primer: CACATGACTATCTAGACATTTTATTTATC
Product Length171
Publication[view all]
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward primerH3C06.Forward primerCicer arietinumprimer
Reverse primerH3C06.Reverse primerCicer arietinumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
H3C06H3C06Cicer arietinummarker_locus


Germplasm
Stock NameType
Hadascultivar