H4H08, H4H08 (genetic_marker) Cicer arietinum

Marker Overview
NameH4H08
Genbank IDN/A
TypeSSR
SpeciesCicer arietinum
GermplasmHadas
Repeat Motif(TAA)29 GAA (CAA)6 (TAA)17 (CAA)4
Primer 1H4H08.Forward primer: GTGTAACTACAACACATATACCAACCA
Primer 2H4H08.Reverse primer: TATTACTTTCTCACTTGAATCGTGAAG
Product Length329
Publication[view all]
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward primerH4H08.Forward primerCicer arietinumprimer
Reverse primerH4H08.Reverse primerCicer arietinumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
H4H08H4H08Cicer arietinummarker_locus


Germplasm
Stock NameType
Hadascultivar
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1chickpea-ICCV96029xCDCFrontier-F2LG2N/A54.3H4H08View
2chickpea-ICCV96029xCDCLuna-F2LG2N/A15.2H4H08View
3chickpea-ICCV96029xCDCFrontier-F2-2007LG2N/A54.3H4H08View
4chickpea-ICC3996xILWC184-F2LG2N/A1H4H08View
5chickpea-ILC588xILC3279-RIL-F6LG2N/A0.8H4H08View