H5B06, H5B06 (genetic_marker) Cicer arietinum

Name	H5B06
Genbank ID	N/A
Type	SSR
Species	Cicer arietinum
Germplasm	Hadas
Repeat Motif	(TC)6 TT (TC)5
Primer 1	H5B06.Forward primer: TGTCCAATTACATGGTAATGCTT
Primer 2	H5B06.Reverse primer: CACAAAAACAAATTCTTCGACTG
Product Length	266
Publication	[view all]

Aligned Feature	Feature Type	Alignment Location
Ca6	chromosome	Ca6:33679346..33679611 .
chr6	chromosome	chr6:33679346..33679611 .

Year	Publication
2005	Lichtenzveig J, Scheuring C, Dodge J, Abbo S, Zhang HB. Construction of BAC and BIBAC libraries and their applications for generation of SSR markers for genome analysis of chickpea, Cicer arietinum L. TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2005 Feb; 110(3):492-510.

Stock Name	Type
Hadas	accession