H6D11, H6D11 (genetic_marker) Cicer arietinum

Name	H6D11
Genbank ID	N/A
Type	SSR
Species	Cicer arietinum
Germplasm	Hadas
Repeat Motif	(TAA)11
Primer 1	H6D11.Forward primer: AAAGATGGGAACTTGAGATGTTG
Primer 2	H6D11.Reverse primer: AATAGCTACTCAAGGCTGAAGAAA
Product Length	200
Publication	[view all]

Feature Name	Type	Location	Analysis	Reference
scaffold284	supercontig	scaffold284:548073..548281 .	Cicer arietinum CDC Frontier genome v1.0	PCD marker alignment to genome using primer sequences
scaffold284	chromosome	scaffold284:548073..548281 .	Cicer arietinum CDC Frontier NCBI RefSeq v1	PCD marker alignment to genome using primer sequences

Year	Publication
2005	Lichtenzveig J, Scheuring C, Dodge J, Abbo S, Zhang HB. Construction of BAC and BIBAC libraries and their applications for generation of SSR markers for genome analysis of chickpea, Cicer arietinum L. TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2005 Feb; 110(3):492-510.

Stock Name	Type
Hadas	accession

#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	chickpea-HadasxICC5810-RIL	LG2	N/A	25	H6D11	View
2	chickpea-ICC3996xILWC184-F2	LG2	N/A	1	H6D11	View
3	chickpea-ICCV96029×CDCFrontier-F2-2017	CaLG02	N/A	5.9	H6D11	View
4	chickpea-ICC5810×CDCFrontier-F2-2017	CaLG02	N/A	28.9	H6D11	View
5	chickpea-BGD132×CDCFrontier-F2-2017	CaLG02	N/A	3.9	H6D11	View
6	chickpea-flowering_time_consensus_map-F2-2017	CaLG02	N/A	29.4	H6D11	View