ICCeM0033, ICCeM0033 (genetic_marker) Cicer arietinum | PulseDB

Marker Overview

Marker Overview


Name	ICCeM0033
Genbank ID	N/A
Type	SSR
Species	Cicer arietinum
Repeat Motif	(CT)16
Primer 1	ICCeM0033.Forward primer: AGCGTGTTCCATTCTGCTCT
Primer 2	ICCeM0033.Reverse primer: TAGGACAATTCGAGGGTTCG
Product Length	162
Publication	[view all]

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
Ca7	chromosome	Ca7:5974820..5974983 .
chr7	chromosome	chr7:5974820..5974983 .

Publications


Year	Publication
2009	Varshney RK, Hiremath PJ, Lekha P, Kashiwagi J, Balaji J, Deokar AA, Vadez V, Xiao Y, Srinivasan R, Gaur PM, Siddique KH, Town CD, Hoisington DA. A comprehensive resource of drought- and salinity- responsive ESTs for gene discovery and marker development in chickpea (Cicer arietinum L.). BMC genomics. 2009; 10:523.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	chickpea-ICC4958xPI489777-RIL-2011	LG2	N/A	101.6	ICCeM0033	View
2	chickpea-ICC4958xPI489777-RIL-F10-2012	LG02	N/A	30.74	ICCeM0033	View