|
Marker Overview
Name | ICCeM0048 |
Genbank ID | N/A |
Type | SSR |
Species | Cicer arietinum |
Repeat Motif | (AG)15 |
Primer 1 | ICCeM0048.Forward primer: TTTCAATACCAATTCTTATTCTCAAG |
Primer 2 | ICCeM0048.Reverse primer: TGCTGCTGATGTTCAAAACC |
Product Length | 134 |
Publication | [view all] |
Alignments
The following features are aligned
Publications
Year | Publication |
2009 | Varshney RK, Hiremath PJ, Lekha P, Kashiwagi J, Balaji J, Deokar AA, Vadez V, Xiao Y, Srinivasan R, Gaur PM, Siddique KH, Town CD, Hoisington DA. A comprehensive resource of drought- and salinity- responsive ESTs for gene discovery and marker development in chickpea (Cicer arietinum L.). BMC genomics. 2009; 10:523. |
|