NCPGR173, NCPGR173 (genetic_marker) Cicer arientinum | PulseDB

Marker Overview

Marker Overview


Name	NCPGR173
Genbank ID	EU877340
Type	STMS
Species	Cicer arietinum
Repeat Motif	(AT)4(GT)12
Primer 1	NCPGR173.Forward primer: AATCTTTGGGGATAAAGGAG
Primer 2	NCPGR173.Reverse primer: ATGTGACCAAAGTAAGGGTG
Product Length	266
Publication	[view all]

References

External references for this genetic_marker


Database	Accession
DB:genbank	EU877340

Publications


Year	Publication
2011	Gaur R, Sethy NK, Choudhary S, Shokeen B, Gupta V, Bhatia S. Advancing the STMS genomic resources for defining new locations on the intraspecific genetic linkage map of chickpea (Cicer arietinum L.). BMC genomics. 2011; 12:117.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Chickpea-ICC4958× ICC1882-RIL	CaLG03	N/A	57.2	NCPGR173	View