NCPGR254, NCPGR254 (genetic_marker) Cicer arientinum | PulseDB

Marker Overview

Marker Overview


Name	NCPGR254
Genbank ID	EU877421
Type	STMS
Species	Cicer arietinum
Repeat Motif	(AT)2(GT)11
Primer 1	NCPGR254.Forward primer: GCCTTTTTCAATTTCTCTCA
Primer 2	NCPGR254.Reverse primer: CCCAAAGAAGACAAAACAAC
Product Length	298
Publication	[view all]

References

External references for this genetic_marker


Database	Accession
DB:genbank	EU877421

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
Ca5	chromosome	Ca5:22273433..22273742 .
chr5	chromosome	chr5:22273433..22273742 .

Publications


Year	Publication
2011	Gaur R, Sethy NK, Choudhary S, Shokeen B, Gupta V, Bhatia S. Advancing the STMS genomic resources for defining new locations on the intraspecific genetic linkage map of chickpea (Cicer arietinum L.). BMC genomics. 2011; 12:117.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	chickpea-ICC4958xPI489777-RIL-2012	LG5	N/A	69	NCPGR254	View
2	chickpea-ICCV2xJG62-RIL-F10-2011	LGVI	N/A	126.7	NCPGR254	View
3	chickpea-ICC4958xPI489777-RIL-2012-2	LG5	N/A	173.1	NCPGR254	View
4	chickpea-ICC4958xPI489777-RIL-2015-2	LG4	N/A	62.09	NCPGR254	View
5	Chickpea-ICC4958× ICC1882-RIL	CaLG05	N/A	35.41	NCPGR254	View
6	Chickpea-ICC4958/PI489777-RIL-2020	LG04	N/A	152.32	NCPGR254	View