NCPGR273, NCPGR273 (genetic_marker) Cicer arientinum | PulseDB

Marker Overview

Marker Overview


Name	NCPGR273
Genbank ID	EU877440
Type	STMS
Species	Cicer arietinum
Repeat Motif	(CA)11
Primer 1	NCPGR273.Forward primer: CCATCTTCAAAAGTGAACCT
Primer 2	NCPGR273.Reverse primer: TCAGTGGTATTGAGACATCG
Product Length	273
Publication	[view all]

References

External references for this genetic_marker


Database	Accession
DB:genbank	EU877440

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
scaffold1751	supercontig	scaffold1751:489722..489979 .
scaffold1751	chromosome	scaffold1751:489722..489979 .

Publications


Year	Publication
2011	Gaur R, Sethy NK, Choudhary S, Shokeen B, Gupta V, Bhatia S. Advancing the STMS genomic resources for defining new locations on the intraspecific genetic linkage map of chickpea (Cicer arietinum L.). BMC genomics. 2011; 12:117.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	chickpea-ICC4958xPI489777-RIL-2012	LG7	N/A	245.1	NCPGR273	View
2	chickpea-ICCV2xJG62-RIL-F10-2011	LGVI	N/A	103.6	NCPGR273	View
3	chickpea-ICC4958xPI489777-RIL-2012-2	LG7	N/A	193.2	NCPGR273	View
4	chickpea-ICC4958xPI489777-RIL-2015-2	LG5	N/A	0	NCPGR273	View
5	Chickpea-ICC4958× ICC1882-RIL	CaLG03	N/A	56.03	NCPGR273	View
6	Chickpea-ICC4958/PI489777-RIL-2020	LG05	N/A	168.6	NCPGR273	View