PBC_CA_00003, PBC_CA_00003 (genetic_marker) Cicer arietinum | PulseDB

Marker Overview

Marker Overview


Name	PBC_CA_00003
Genbank ID	N/A
Type	SSR
Species	Cicer arietinum
Repeat Motif	TGGC
Primer 1	PBC_CA_00003.Forward primer: ATCTTTGGGCAATAGTCACTT
Primer 2	PBC_CA_00003.Reverse primer: GCAGTCCATGACTAAGGTGT
Product Length	144
Publication	[view all]

Publications


Year	Publication
2014	Stephens A, Lombardi M, Cogan NOI, Forster JW, Hobson K, Materne M, Kaur S. Genetic marker discovery, intraspecific linkage map construction and quantitative trait locus analysis of ascochyta blight resistance in chickpea (Cicer arietinum L.). Molecular breeding. 2014; 33(2):297-313.