PBC_CA_00009, PBC_CA_00009 (genetic_marker) Cicer arietinum | PulseDB

Marker Overview

Marker Overview


Name	PBC_CA_00009
Genbank ID	N/A
Type	SSR
Species	Cicer arietinum
Repeat Motif	TCC
Primer 1	PBC_CA_00009.Forward primer: TTTTCACACTCCAAATGAAAC
Primer 2	PBC_CA_00009.Reverse primer: ACAAAGCTTCTAGATCCCAAT
Product Length	155
Publication	[view all]

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
Ca7	chromosome	Ca7:1293866..1294020 .
chr7	chromosome	chr7:1293866..1294020 .

Publications


Year	Publication
2014	Stephens A, Lombardi M, Cogan NOI, Forster JW, Hobson K, Materne M, Kaur S. Genetic marker discovery, intraspecific linkage map construction and quantitative trait locus analysis of ascochyta blight resistance in chickpea (Cicer arietinum L.). Molecular breeding. 2014; 33(2):297-313.