PBC_CA_00093, PBC_CA_00093 (genetic_marker) Cicer arietinum | PulseDB

Marker Overview

Marker Overview


Name	PBC_CA_00093
Genbank ID	N/A
Type	SSR
Species	Cicer arietinum
Repeat Motif	AATG
Primer 1	PBC_CA_00093.Forward primer: TCCTGTCGTTTTCTTTCTCTA
Primer 2	PBC_CA_00093.Reverse primer: TTTCAGAAATGCCACATACAT
Product Length	161
Publication	[view all]

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
Ca5	chromosome	Ca5:208008..208168 .
chr5	chromosome	chr5:208008..208168 .

Publications


Year	Publication
2014	Stephens A, Lombardi M, Cogan NOI, Forster JW, Hobson K, Materne M, Kaur S. Genetic marker discovery, intraspecific linkage map construction and quantitative trait locus analysis of ascochyta blight resistance in chickpea (Cicer arietinum L.). Molecular breeding. 2014; 33(2):297-313.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	chickpea-LasseterxICC3996-F6-RIL	LG7.2	N/A	17.6	PBC_CA_00093	View