PBC_CA_00307, PBC_CA_00307 (genetic_marker) Cicer arietinum | PulseDB

Marker Overview

Marker Overview


Name	PBC_CA_00307
Genbank ID	N/A
Type	SSR
Species	Cicer arietinum
Repeat Motif	TA
Primer 1	PBC_CA_00307.Forward primer: CAGTCTCTACTGGGGGTTATT
Primer 2	PBC_CA_00307.Reverse primer: TGAAATGATATCCTTCCGAAT
Product Length	140
Publication	[view all]

Alignments

The following features are aligned


Feature Name	Type	Location	Analysis	Reference
scaffold3542	supercontig	scaffold3542:27652..27791 .	Cicer arietinum CDC Frontier genome v1.0	PCD marker alignment to genome using primer sequences
chloroplast	chromosome	chloroplast:62553..62692 .	Cicer arietinum CDC Frontier NCBI RefSeq v1	PCD marker alignment to genome using primer sequences

Publications


Year	Publication
2014	Stephens A, Lombardi M, Cogan NOI, Forster JW, Hobson K, Materne M, Kaur S. Genetic marker discovery, intraspecific linkage map construction and quantitative trait locus analysis of ascochyta blight resistance in chickpea (Cicer arietinum L.). Molecular breeding. 2014; 33(2):297-313.