PBC_CA_00395, PBC_CA_00395 (genetic_marker) Cicer arietinum | PulseDB

Marker Overview

Marker Overview


Name	PBC_CA_00395
Genbank ID	N/A
Type	SSR
Species	Cicer arietinum
Repeat Motif	CAGGTG
Primer 1	PBC_CA_00395.Forward primer: GACATTGGATGGGTTAAGAAT
Primer 2	PBC_CA_00395.Reverse primer: AGAAGCCATGAAAGAAGAAAT
Product Length	145
Publication	[view all]

Alignments

The following features are aligned


Feature Name	Type	Location	Analysis	Reference
Ca6	chromosome	Ca6:17730317..17730461 .	Cicer arietinum CDC Frontier genome v1.0	PCD marker alignment to genome using primer sequences
chr6	chromosome	chr6:17730317..17730461 .	Cicer arietinum CDC Frontier NCBI RefSeq v1	PCD marker alignment to genome using primer sequences

Publications


Year	Publication
2014	Stephens A, Lombardi M, Cogan NOI, Forster JW, Hobson K, Materne M, Kaur S. Genetic marker discovery, intraspecific linkage map construction and quantitative trait locus analysis of ascochyta blight resistance in chickpea (Cicer arietinum L.). Molecular breeding. 2014; 33(2):297-313.