PBC_CA_00919, PBC_CA_00919 (genetic_marker) Cicer arietinum | PulseDB

Marker Overview

Marker Overview


Name	PBC_CA_00919
Genbank ID	N/A
Type	SSR
Species	Cicer arietinum
Repeat Motif	TTTC
Primer 1	PBC_CA_00919.Forward primer: ACTCAAAGACACACTTCTCCA
Primer 2	PBC_CA_00919.Reverse primer: CTTCACGTGGATCATAACCTA
Product Length	149
Publication	[view all]

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
Ca8	chromosome	Ca8:807634..807952 .
chr8	chromosome	chr8:807634..807952 .

Publications


Year	Publication
2014	Stephens A, Lombardi M, Cogan NOI, Forster JW, Hobson K, Materne M, Kaur S. Genetic marker discovery, intraspecific linkage map construction and quantitative trait locus analysis of ascochyta blight resistance in chickpea (Cicer arietinum L.). Molecular breeding. 2014; 33(2):297-313.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	chickpea-LasseterxICC3996-F6-RIL	LG2.1	N/A	0	PBC_CA_00919	View
2	chickpea-S95362xHowzat-F6-RIL	LG2.1	N/A	0	PBC_CA_00919	View