SCAI09-1276, SCAI09-1276 (genetic_marker) Cicer arietinum | PulseDB

Marker Overview

Marker Overview


Name	SCAI09-1276
Genbank ID	AY860666
Type	SCAR
Species	Cicer arietinum
Primer 1	SCAI09-1276.Forward primer: TCGCTGGTGTCTATAGTGGC
Primer 2	SCAI09-1276.Reverse primer: GGTGTGTGCCATAGGGAGAA
Publication	[view all]

References

External references for this genetic_marker


Database	Accession
DB:genbank	AY860666

Publications


Year	Publication
2006	Iruela M, Rubio J, Barro F, Cubero JI, Millán T, Gil J. Detection of two quantitative trait loci for resistance to ascochyta blight in an intra-specific cross of chickpea (Cicer arietinum L.): development of SCAR markers associated with resistance. TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2006 Jan; 112(2):278-87.