TA104, TA104 (genetic_marker) Cicer arietinum

Name	TA104
Genbank ID	N/A
Type	STMS
Species	Cicer arietinum
Germplasm	ILC3279
Repeat Motif	(TAA)19
Primer 1	TA104.Forward primer: TGACACCCTAAACCCTAAAA
Primer 2	TA104.Reverse primer: AATTCATTTGTGTCATTGGC
Product Length	240
Publication	[view all]

Year	Publication
1999	Winter P, Pfaff T, Udupa SM, Huttel B, Sharma PC, Sahi S, Arrequin-Espinoza R, Weigand F, Muehlbauer FJ, Kahl G. Characterization and mapping of sequence-tagged microsatellite sites in the chickpea (Cicer arietinum L.) genome. Mol Gen Genet. 1999; 262:90-101.

Stock Name	Type
ILC3279	accession

#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	chickpea-ICCV96029xCDCLuna-F2	LG5	N/A	43.1	TA104	View
2	chickpea-ICCV96029xCDCLuna-F2	LG7	N/A	0	TA104	View