TA146, TA146 (genetic_marker) Cicer arietinum

Marker Overview
NameTA146
Genbank IDN/A
TypeSTMS
SpeciesCicer arietinum
GermplasmILC3279
Repeat Motif(TTA)29
Primer 1TA146.Forward primer: CTAAGTTTAATATGTTAGTCCTTAAATTAT
Primer 2TA146.Reverse primer: ACGAACGCAACATTAATTTTATATT
Product Length161
Publication[view all]
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
TA146.Forward primerTA146.Forward primerCicer arietinumprimer
TA146.Reverse primerTA146.Reverse primerCicer arietinumprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
100-seed weightqSDWT.ICC3996xS95362.LG4.HCicer arietinumQTL
100-seed weightqSDWT.ICC3996xS95362.LG4.WCicer arietinumQTL
Seed diameterqSDDIA.ICC3996xS95362.LG4.HCicer arietinumQTL
Seed diameterqSDDIA.ICC3996xS95362.LG4.WCicer arietinumQTL
Ascochyta blight resistanceqABR.ICCV96029xCDCFrontier.LG4Cicer arietinumQTL
Ascochyta blight resistanceqABR.ICC12004xLasseter.LG3.cont.IDSCicer arietinumQTL
Ascochyta blight resistanceqABR.ICC12004xLasseter.LG3.cont.AUDCPCicer arietinumQTL
Ascochyta blight resistanceqABR.ICC12004xLasseter.LG3.field.IDSCicer arietinumQTL
Ascochyta blight resistanceqABR.ILC3279xWR315.LG4b.2003Cicer arietinumQTL
Ascochyta blight resistanceqABR.LasseterxICC3996-LG4.1.2005Cicer arietinumQTL
Ascochyta blight resistanceqABR.LasseterxICC3996-LG4.1.2009Cicer arietinumQTL
Ascochyta blight resistanceqABR.S95362xHowzat-LG4.2005Cicer arietinumQTL
Ascochyta blight resistanceqABR.S95362xHowzat-LG4.2009Cicer arietinumQTL


This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
Plant widthqPLWTH.JG62xVijay.LG4.IVCicer arietinumQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
TA146TA146Cicer arietinummarker_locus


Germplasm
Stock NameType
ILC3279breeding_research_material
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1chickpea-C214xWR315-F2LG4N/A14TA146View
2chickpea-ICC4991xICCV04516-F2LG4N/A35.2TA146View
3chickpea-ICCV2xJG62-RILLG6N/A44.1TA146View
4chickpea-ICCV96029xCDCFrontier-F2LG4N/A141.7TA146View
5chickpea-ILC588xILC3279-RILLG4N/A42.7TA146View
6chickpea-JG62xVijay-RIL-2011LG1N/A61.9TA146View
7chickpea-JG62xVijay-VijayxICC4958-RILLG2N/A62.3TA146View
8chickpea-VijayxICC4958-RIL-2011LG1aN/A53.4TA146View
9chickpea-ICC4958xPI489777-RIL-2011LG4N/A53.6TA146View
10chickpea-ICC4958xPI489777-RIL-2012LG4N/A48.6TA146View
11chickpea-ICCV2xJG62-RIL-F10-2011LGIVN/A40.5TA146View
12chickpea-ICCV2xJG62-RIL-F10-2011LGVIN/A96.3TA146View
13chickpea-ICC4958xPI489777-RIL-2012-2LG4N/A76TA146View
14chickpea-ICC4958xPI489777-RIL-F10LG4N/A73.24TA146View
15chickpea-ICCV96029xCDCFrontier-F2-2007LG4N/A141.7TA146View
16chickpea-ILC3279xWR315-RILLG4bN/A16.7TA146View
17chickpea-ILC72xCr5-10-RIL-2006LG4N/A95.1TA146View
18chickpea-ICC4958xPI489777-RIL-F10-2012LG04N/A41.58TA146View
19chickpea-ICC12004xLasseter-F2LGIIIN/A33.6TA146View
20chickpea-ICC3996xILWC184-F2LG4N/A13.5TA146View
21chickpea-LasseterxICC3996-F6-RILLG4.1N/A33.8TA146View
22chickpea-S95362xHowzat-F6-RILLG4N/A55.2TA146View
23chickpea-ICC4958xPI489777-RIL-2010LG4N/A244.1TA146View
24chickpea-ICC4958xPI489777-RIL-2010LG6N/A14.6TA146View
25chickpea-ICC4958xPI489777-RIL-2015-2LG4N/A86.16TA146View
26Chickpea-JG62xVijayxVijayxICC4958-RILLG2 (LGI+IV)N/A62.3TA146View
27chickpea-C214xWR315-F2LG6N/A62.4TA146View
28Chickpea-RIP5-OrtegaLG04-2N/A5.7TA146View
29Chickpea-RIP8-OrtegaLG04-2N/A12.9TA146View
30Chickpea-ICC4958/PI489777-RIL-2020LG04N/A162.45TA146View