TA30, TA30 (genetic_marker) Cicer arietinum

Marker Overview
NameTA30
Genbank IDN/A
TypeSTMS
SpeciesCicer arietinum
GermplasmILC3279
Repeat Motif(TAA)18TA(TAA)19
Primer 1TA30.Forward primer: TCATTAAAATTCTATTGTCCTGTCCTT
Primer 2TA30.Reverse primer: ATCGTTTTTCTAAACTAAATTGTGCAT
Product Length217
Publication[view all]
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward primerTA30.Forward primerCicer arietinumprimer
Reverse primerTA30.Reverse primerCicer arietinumprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
Days to first flowerqFLTM.ICC5810_x_CDCFrontier-CaLG1.Qefl2-1Cicer arietinumQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
TA30TA30Cicer arietinummarker_locus
TA30TA30-13.02Cicer arietinummarker_locus


Germplasm
Stock NameType
ILC3279breeding_research_material