TA34, TA34 (genetic_marker) Cicer arietinum

Marker Overview


Name	TA34
Genbank ID	N/A
Type	STMS
Species	Cicer arietinum
Germplasm	ILC3279
Repeat Motif	(AAT)34
Primer 1	TA34.Forward primer: AAGAGTTGTTCCCTTTCTTTT
Primer 2	TA34.Reverse primer: CCATTATCATTCTTGTTTTCAA
Product Length	230
Publication	[view all]

Relationships

This genetic_marker is adjacent to the following primer feature(s):


Feature Name	Unique Name	Species	Type
Forward primer	TA34.Forward primer	Cicer arietinum	primer
Reverse primer	TA34.Reverse primer	Cicer arietinum	primer

This genetic_marker is located in the following QTL feature(s):


Feature Name	Unique Name	Species	Type
Ascochyta blight resistance	qABR.ICC3996xILWC184.LG3	Cicer sp.	QTL

The following marker_locus feature(s) are an instance of this genetic_marker:


Feature Name	Unique Name	Species	Type
TA34	TA34	Cicer arietinum	marker_locus
TA34	TA34-1.71	Cicer arietinum	marker_locus

Publications


Year	Publication
1999	Winter P, Pfaff T, Udupa SM, Huttel B, Sharma PC, Sahi S, Arrequin-Espinoza R, Weigand F, Muehlbauer FJ, Kahl G. Characterization and mapping of sequence-tagged microsatellite sites in the chickpea (Cicer arietinum L.) genome. Mol Gen Genet. 1999; 262:90-101.

Germplasm


Stock Name	Type
ILC3279	breeding_research_material

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	chickpea-ICC4991xICCV04516-F2	LG3	N/A	20	TA34	View
2	chickpea-JG62xVijay-VijayxICC4958-RIL	LG1	N/A	23.9	TA34	View
3	chickpea-VijayxICC4958-RIL-2011	LG2	N/A	14.6	TA34	View
4	chickpea-ICC4958xPI489777-RIL-2012	LG3	N/A	130.6	TA34	View
5	chickpea-ICC4958xPI489777-RIL-2012-2	LG3	N/A	107.9	TA34	View
6	chickpea-ICC12004xLasseter-F2	LGI	N/A	187.7	TA34	View
7	chickpea-ICC3996xILWC184-F2	LG3	N/A	35	TA34	View
8	chickpea-ICC4958xPI489777-RIL-2010	LG3	N/A	60.4	TA34	View
9	chickpea-ICC4958xPI489777-RIL-2015-2	LG3	N/A	48.73	TA34	View
10	chickpea-ICC5810×CDCFrontier-F2-2017	CaLG03	N/A	0.6	TA34	View
11	chickpea-flowering_time_consensus_map-F2-2017	CaLG03	N/A	14.2	TA34	View
12	Chickpea-ICCL81001_x_Cr5-9-RIL	LG3A	N/A	86.7	TA34	View
13	Chickpea-ICC4958× ICC1882-RIL	CaLG03	N/A	54.3	TA34	View
14	Chickpea-RIP12-Ortega	LG03-2	N/A	14.4	TA34	View
15	Chickpea-ICC4958/PI489777-RIL-2020	LG03	N/A	129.94	TA34	View
16	Chickpea-JG62/ICCV05530-RIL	LG03	N/A	1.71	TA34	View