TA34, TA34 (genetic_marker) Cicer arietinum

Marker Overview
NameTA34
Genbank IDN/A
TypeSTMS
SpeciesCicer arietinum
GermplasmILC3279
Repeat Motif(AAT)34
Primer 1TA34.Forward primer: AAGAGTTGTTCCCTTTCTTTT
Primer 2TA34.Reverse primer: CCATTATCATTCTTGTTTTCAA
Product Length230
Publication[view all]
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward primerTA34.Forward primerCicer arietinumprimer
Reverse primerTA34.Reverse primerCicer arietinumprimer


This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
Ascochyta blight resistanceqABR.ICC3996xILWC184.LG3Cicer sp.QTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
TA34TA34Cicer arietinummarker_locus
TA34TA34-1.71Cicer arietinummarker_locus


Germplasm
Stock NameType
ILC3279breeding_research_material