TA42, TA42 (genetic_marker) Cicer arietinum

Marker Overview
NameTA42
Genbank IDN/A
TypeSTMS
SpeciesCicer arietinum
GermplasmILC3279
Repeat Motif(TA)19; (TAA)41
Primer 1TA42.Forward primer: ATATCGAAATAAATAACAACAGGATGG
Primer 2TA42.Reverse primer: TAGTTGATACTTGGATGATAACCAAAA
Product Length209
Publication[view all]
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
TA42.Forward primerTA42.Forward primerCicer arietinumprimer
TA42.Reverse primerTA42.Reverse primerCicer arietinumprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
100-seed weightqSDWT.ICCV2xJG62.LG7.5ESCicer arietinumQTL
Harvest indexqHI.ICCV2xJG62.LG7.5ECCicer arietinumQTL
Harvest indexqHI.ICCV2xJG62.LG7.5ESCicer arietinumQTL
Pod number per plantqPDPL.ICCV2xJG62.LG7.7ASCicer arietinumQTL
Seed number per plantqSDPL.ICCV2xJG62.LG7.7ESCicer arietinumQTL


This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
Days to maturityqDM.VijayxICC4958.LG2.PCicer arietinumQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
TA42TA42Cicer arietinummarker_locus


Germplasm
Stock NameType
ILC3279breeding_research_material
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1chickpea-ICCV2xJG62-RILLG7N/A1.7TA42View
2chickpea-JG62xVijay-RIL-2011LG8N/A30.9TA42View
3chickpea-JG62xVijay-VijayxICC4958-RILLG1N/A59.7TA42View
4chickpea-VijayxICC4958-RIL-2011LG2N/A52.6TA42View
5chickpea-ICCV2xJG62-RIL-F10-2011LGVN/A65.6TA42View
6chickpea-LasseterxICC3996-F6-RILLG5N/A1.4TA42View
7chickpea-S95362xHowzat-F6-RILLG1.1/5N/A84.9TA42View
8Chickpea-JG62xVijayxVijayxICC4958-RILLG1 (LGIII+V+XIII)N/A59.7TA42View
9Chickpea-CA2156_x_JG62-RILRIP-1 LG5N/A31.9TA42View
10Chickpea-ILC3279_x_JG62-RILRIP-7 LG5N/A9.5TA42View
11Chickpea-JG62_x_ILC72-RILRIP-10 LG5N/A25.3TA42View
12Chickpea-Physical_consensusCa5N/A20957513TA42View
13Chickpea-ICCL81001_x_Cr5-9-RILLG5N/A110TA42View
14Chickpea-ICC4958× ICC1882-RILCaLG05N/A13.97TA42View
15Chickpea-RIP12-OrtegaLG05N/A6TA42View
16Chickpea-RIP8-OrtegaLG05N/A1.3TA42View