|
Marker Overview
Name | TA43 |
Genbank ID | N/A |
Type | STMS |
Species | Cicer arietinum |
Germplasm | ILC3279 |
Repeat Motif | (TAA)19 |
Primer 1 | TA43.Forward primer: GGTTGTGTTCTCCAGATTTT |
Primer 2 | TA43.Reverse primer: AAGAGTTGTTGGAGAGCAA |
Product Length | 183 |
Publication | [view all] |
Relationships
This genetic_marker is adjacent to the following primer feature(s):
The following marker_locus feature(s) are an instance of this genetic_marker:
Publications
Year | Publication |
1999 | Winter P, Pfaff T, Udupa SM, Huttel B, Sharma PC, Sahi S, Arrequin-Espinoza R, Weigand F, Muehlbauer FJ, Kahl G. Characterization and mapping of sequence-tagged microsatellite sites in the chickpea (Cicer arietinum L.) genome. Mol Gen Genet. 1999; 262:90-101. |
2007 | Radhika P, Gowda SJM, Kadoo NY, Mhase LB, Jamadagni BM, Sainani MN, Chandra S, Gupta VS. Development of an integrated intraspecific map of chickpea (Cicer arietinum L.) using two recombinant inbred line populations. Theoretical and applied genetics TAG. 2007; 115(2):209-216. |
Germplasm
Stock Name | Type |
ILC3279 | breeding_research_material |
|