TA43, TA43 (genetic_marker) Cicer arietinum

Marker Overview
NameTA43
Genbank IDN/A
TypeSTMS
SpeciesCicer arietinum
GermplasmILC3279
Repeat Motif(TAA)19
Primer 1TA43.Forward primer: GGTTGTGTTCTCCAGATTTT
Primer 2TA43.Reverse primer: AAGAGTTGTTGGAGAGCAA
Product Length183
Publication[view all]
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward primerTA43.Forward primerCicer arietinumprimer
Reverse primerTA43.Reverse primerCicer arietinumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
TA43TA43Cicer arietinummarker_locus
TA43TA43-12.64Cicer arietinummarker_locus


Germplasm
Stock NameType
ILC3279breeding_research_material
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1chickpea-ICC4991xICCV04516-F2LG1N/A48.9TA43View
2chickpea-JG62xVijay-VijayxICC4958-RILLG1N/A56.6TA43View
3chickpea-VijayxICC4958-RIL-2011LG2N/A46.8TA43View
4chickpea-ICC4958xPI489777-RIL-2012-2LG5N/A50.6TA43View
5Chickpea-JG62xVijayxVijayxICC4958-RILLG1 (LGIII+V+XIII)N/A56.6TA43View
6Chickpea-JG62/ICCV05530-RILLG01N/A12.64TA43View