TA53, TA53 (genetic_marker) Cicer arietinum

Marker Overview
NameTA53
Genbank IDN/A
TypeSTMS
SpeciesCicer arietinum
GermplasmILC3279
Repeat Motif(TTA)57
Primer 1TA53.Forward primer: GGAGAAAATGGTAGTTTAAAGAGTACTAA
Primer 2TA53.Reverse primer: AAAAATATGAAGACTAACTTTGCATTTA
Product Length249
Publication[view all]
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward primerTA53.Forward primerCicer arietinumprimer
Reverse primerTA53.Reverse primerCicer arietinumprimer


This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
100-seed weightqSDWT.JG62xVijay.LG3.2Cicer arietinumQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
TA53TA53Cicer arietinummarker_locus


Germplasm
Stock NameType
ILC3279breeding_research_material
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1chickpea-ICC4991xICCV04516-F2LG2N/A57.6TA53View
2chickpea-JG62xVijay-RIL-2011LG5N/A23.7TA53View
3chickpea-ILC3279xWR315-RIL-2007LG2N/A40.2TA53View
4chickpea-ICC3996xILWC184-F2LG2N/A44.7TA53View
5Chickpea-JG62xVijayxVijayxICC4958-RILLG3 (LGII+VIII)N/A0TA53View
6Chickpea-RIP5-OrtegaLG02N/A9.4TA53View
7Chickpea-RIP8-OrtegaLG02-1N/A17.3TA53View