TA64, TA64 (genetic_marker) Cicer arietinum

Marker Overview
NameTA64
Genbank IDN/A
TypeSTMS
SpeciesCicer arietinum
GermplasmILC3279
Repeat Motif(TAA)39
Primer 1TA64.Forward primer: ATATATCGTAACTCATTAATCATCCGC
Primer 2TA64.Reverse primer: AAATTGTTGTCATCAAATGGAAAATA
Product Length239
Publication[view all]
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
TA64.Forward primerTA64.Forward primerCicer arietinumprimer
Reverse primerTA64.Reverse primerCicer arietinumprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
Ascochyta blight resistanceqABR.ICCV96029xCDCFrontier.LG3Cicer arietinumQTL
Ascochyta blight resistanceqABR.ICCV96029xAmit.LG3Cicer arietinumQTL
Days to first flowerqFLTM.BGD132_x_CDCFrontier-CaLG3.Qefl3-2Cicer arietinumQTL


This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
Ascochyta blight resistanceqABR.ICCV96029xCDCFrontier.LG3Cicer arietinumQTL
Ascochyta blight resistanceqABR.ICCV96029xAmit.LG3Cicer arietinumQTL
Beta-carotene contentqBCARC.HadasxCr205.LG3BCicer sp.QTL
Days to first flowerqDFFL.ICC3996xILWC184.LG3Cicer sp.QTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
TA64TA64Cicer arietinummarker_locus


Germplasm
Stock NameType
ILC3279breeding_research_material
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1chickpea-C214xILC3279-F2LG3N/A58.9TA64View
2chickpea-ICC4991xICCV04516-F2LG3N/A0TA64View
3chickpea-ICCV96029xAmit-F2LG3N/A50.4TA64View
4chickpea-ICCV96029xCDCCorinne-F2LG3N/A46.3TA64View
5chickpea-ICCV96029xCDCFrontier-F2LG3N/A72.8TA64View
6chickpea-ICCV96029xCDCLuna-F2LG3N/A55.5TA64View
7chickpea-JG62xVijay-RIL-2011LG2N/A19.1TA64View
8chickpea-JG62xVijay-VijayxICC4958-RILLG1N/A113.1TA64View
9chickpea-VijayxICC4958-RIL-2011LG1aN/A92.6TA64View
10chickpea-ICCV2xJG62-RIL-F10-2011LGIIIN/A29.8TA64View
11chickpea-ICC4958xPI489777-RIL-2012-2LG3N/A126.8TA64View
12chickpea-ICC4958xPI489777-RIL-F10LG3N/A51.29TA64View
13chickpea-ICCV96029xCDCFrontier-F2-2007LG3N/A72.8TA64View
14chickpea-HadasxCr205-F2LG3BN/A23.5TA64View
15chickpea-ICC4958xPI489777-RIL-F10-2012LG03N/A63.86TA64View
16chickpea-ICC3996xILWC184-F2LG3N/A59.6TA64View
17chickpea-LasseterxICC3996-F6-RILLG3N/A31.3TA64View
18chickpea-S95362xHowzat-F6-RILLG3N/A34.6TA64View
19chickpea-ICC4958xPI489777-RIL-2010LG3N/A175.6TA64View
20chickpea-ICC4958xPI489777-RIL-2015-2LG3N/A48.39TA64View
21Chickpea-JG62xVijayxVijayxICC4958-RILLG1 (LGIII+V+XIII)N/A113.1TA64View
22chickpea-ICCV96029×CDCFrontier-F2-2017CaLG03N/A43.7TA64View
23chickpea-ICC5810×CDCFrontier-F2-2017CaLG03N/A40.9TA64View
24chickpea-BGD132×CDCFrontier-F2-2017CaLG03N/A41.7TA64View
25chickpea-ICC16641×CDCFrontier-F2-2017CaLG03N/A34.6TA64View
26chickpea-flowering_time_consensus_map-F2-2017CaLG03N/A24.2TA64View
27Chickpea-ICCL81001_x_Cr5-9-RILLG3AN/A0TA64View
28Chickpea-ICC4958× ICC1882-RILCaLG03N/A12.6TA64View
29Chickpea-RIP12-OrtegaLG03-2N/A1.6TA64View
30Chickpea-RIP8-OrtegaLG03-2N/A21.2TA64View