TFGMS1095, TFGMS1095 (genetic_marker) Cicer arietinum | PulseDB

Marker Overview

Marker Overview


Name	TFGMS1095
Genbank ID	Pr016586068
Type	SSR
Species	Cicer arietinum
Germplasm	ICC4958
Repeat Motif	(GAT)4
Primer 1	TFGMS1095.Forward primer: ATCAAGCTGTTTGGTAGAACA
Primer 2	TFGMS1095.Reverse primer: GATATCCCTTCTTGACCAACT
Product Length	149
Publication	[view all]

References

External references for this genetic_marker


Database	Accession
DB:genbank	Pr016586068

Alignments

The following features are aligned


Feature Name	Type	Location	Analysis	Reference
scaffold1006	supercontig	scaffold1006:424366..424514 .	Cicer arietinum CDC Frontier genome v1.0	PCD marker alignment to genome using primer sequences
scaffold1006	chromosome	scaffold1006:424366..424514 .	Cicer arietinum CDC Frontier NCBI RefSeq v1	PCD marker alignment to genome using primer sequences

Publications


Year	Publication
2013	Kujur A, Bajaj D, Saxena MS, Tripathi S, Upadhyaya HD, Gowda CL, Singh S, Jain M, Tyagi AK, Parida SK. Functionally relevant microsatellite markers from chickpea transcription factor genes for efficient genotyping applications and trait association mapping. DNA research : an international journal for rapid publication of reports on genes and genomes. 2013 Aug; 20(4):355-74.

Germplasm


Stock Name	Type
ICC4958	accession