TFGMS768, TFGMS768 (genetic_marker) Cicer arietinum

Marker Overview
NameTFGMS768
Genbank IDPr016585741
TypeSSR
SpeciesCicer arietinum
GermplasmICC4958
Repeat Motif(AG)6
Primer 1TFGMS768.Forward primer: GTAGAAAAGGGAGAGATGGAA
Primer 2TFGMS768.Reverse primer: TAACGTCTCCAAAAATCTCAA
Product Length159
Publication[view all]
References
External references for this genetic_marker
DatabaseAccession
DB:genbankPr016585741
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward primerTFGMS768.Forward primerCicer arietinumprimer
Reverse primerTFGMS768.Reverse primerCicer arietinumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
TFGMS768TFGMS768Cicer arietinummarker_locus


Germplasm
Stock NameType
ICC4958cultivar
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Chickpea-ICCX-810800xICC 20268-RILCaChr1N/A5.67TFGMS768View