TR58, TR58 (genetic_marker) Cicer arietinum

Marker Overview
NameTR58
Genbank IDN/A
TypeSTMS
SpeciesCicer arietinum
GermplasmILC3279
Repeat Motif(TAA)21
Primer 1TR58.Forward primer: CTCTATATTTGTTTGTTTTTCGTTTTG
Primer 2TR58.Reverse primer: TAAAATGTGTAGGGTGCAGAATAAATA
Product Length246
Publication[view all]
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
TR58.Forward primerTR58.Forward primerCicer arietinumprimer
TR58.Reverse primerTR58.Reverse primerCicer arietinumprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
Ascochyta blight resistanceqABR.ICC 4991xICCV04516.LG3.AdultCicer arietinumQTL
Ascochyta blight resistanceqABR.ILC3279xWR315.LG2.2002Cicer arietinumQTL
Ascochyta blight resistanceqABR.ILC3279xWR315.LG2.2003Cicer arietinumQTL


This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
Harvest indexqHI.ILC588xILC3279.LG2.TH-cont08Cicer arietinumQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
TR58TR58Cicer arietinummarker_locus
TR58L1TR58L1Cicer arietinummarker_locus
TR58-L1TR58-L1Cicer arietinummarker_locus


Germplasm
Stock NameType
ILC3279breeding_research_material
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1chickpea-ICC4991xICCV04516-F2LG3N/A104.3TR58View
2chickpea-ICCV2xJG62-RILLG1N/A5.6TR58View
3chickpea-JG62xVijay-RIL-2011LG8N/A38.4TR58View
4chickpea-ICC4958xPI489777-RIL-2012LG2N/A64.3TR58View
5chickpea-ICC4958xPI489777-RIL-2012-2LG2N/A69.5TR58View
6chickpea-ILC3279xWR315-RIL-2007LG2N/A43TR58View
7chickpea-ICC4958xPI489777-RIL-2015-2LG2N/A70.81TR58View
8Chickpea-ICCL81001_x_Cr5-9-RILLG2N/A64.7TR58View
9Chickpea-JG62_X_WR315-RILLG2N/A146.5TR58View
10Chickpea-RIP12-OrtegaLG02N/A12.3TR58View
11Chickpea-ICC4958/PI489777-RIL-2020LG02N/A65.53TR58View
12Chickpea-RIP5-OrtegaLG02N/A7.2TR58L1View
13Chickpea-RIP8-OrtegaLG02-1N/A18.6TR58-L1View