|
|
Marker Overview
| Name | TR58 |
|---|
| Genbank ID | N/A |
|---|
| Type | STMS |
|---|
| Species | Cicer arietinum |
|---|
| Germplasm | ILC3279 |
|---|
| Repeat Motif | (TAA)21 |
|---|
| Primer 1 | TR58.Forward primer: CTCTATATTTGTTTGTTTTTCGTTTTG |
|---|
| Primer 2 | TR58.Reverse primer: TAAAATGTGTAGGGTGCAGAATAAATA |
|---|
| Product Length | 246 |
|---|
| Publication | [view all] |
|---|
Relationships
This genetic_marker is adjacent to the following primer feature(s):
| Feature Name | Unique Name | Species | Type |
|---|
| TR58.Forward primer | TR58.Forward primer | Cicer arietinum | primer |
| TR58.Reverse primer | TR58.Reverse primer | Cicer arietinum | primer |
This genetic_marker is adjacent to the following QTL feature(s):
This genetic_marker is located in the following QTL feature(s):
The following marker_locus feature(s) are an instance of this genetic_marker:
Publications
| Year | Publication |
|---|
| 1999 | Winter P, Pfaff T, Udupa SM, Huttel B, Sharma PC, Sahi S, Arrequin-Espinoza R, Weigand F, Muehlbauer FJ, Kahl G. Characterization and mapping of sequence-tagged microsatellite sites in the chickpea (Cicer arietinum L.) genome. Mol Gen Genet. 1999; 262:90-101. |
| 2014 | Patil B, Ravikumar R, Bhat J, Soregaon C. Molecular mapping of QTLs for resistance to early and late Fusarium wilt in chickpea. Czech journal of genetics and plant breeding. 2014; 50(2):171-176. |
Germplasm
| Stock Name | Type |
|---|
| ILC3279 | breeding_research_material |
|
