TS23, TS23 (genetic_marker) Cicer arietinum

Name	TS23
Genbank ID	N/A
Type	STMS
Species	Cicer arietinum
Germplasm	ILC3279
Repeat Motif	(TAA)24
Primer 1	TS23.Forward primer: CACCTAATTTTGTCCGACTT
Primer 2	TS23.Reverse primer: CAAACAAGAACCGAAAACAC
Product Length	208
Publication	[view all]

Year	Publication
1999	Winter P, Pfaff T, Udupa SM, Huttel B, Sharma PC, Sahi S, Arrequin-Espinoza R, Weigand F, Muehlbauer FJ, Kahl G. Characterization and mapping of sequence-tagged microsatellite sites in the chickpea (Cicer arietinum L.) genome. Mol Gen Genet. 1999; 262:90-101.

Stock Name	Type
ILC3279	accession

#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	chickpea-ILC588xILC3279-RIL-F6	LG5	N/A	0	TS23	View