TS72, TS72 (genetic_marker) Cicer arietinum

Marker Overview
NameTS72
Genbank IDN/A
TypeSTMS
SpeciesCicer arietinum
GermplasmILC3279
Repeat Motif(ATT)39
Primer 1TS72.Forward primer: CAAACAATCACTAAAAGTATTTGCTCT
Primer 2TS72.Reverse primer: AAAAATTGATGGACAAGTGTTATTATG
Product Length264
Publication[view all]
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
TS72.Forward primerTS72.Forward primerCicer arietinumprimer
TS72.Reverse primerTS72.Reverse primerCicer arietinumprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
Ascochyta blight resistanceqABR.ICCV96029xCDCCorinne.LG4Cicer arietinumQTL
Fusarium wilt incidenceqFWI.JG62/ICCV05530.LG4.LuCicer arietinumQTL


This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
Plant widthqPLWTH.VijayxICC4958.LG1a.IV.2Cicer arietinumQTL
Plant widthqPLWTH.VijayxICC4958.LG1a.P.2Cicer arietinumQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
TS72TS72Cicer arietinummarker_locus
TS72TS72-9.14Cicer arietinummarker_locus


Germplasm
Stock NameType
ILC3279breeding_research_material