A2, A2 (genetic_marker) Pisum sativum

Marker Overview
NameA2
Genbank IDN/A
TypeSSR
SpeciesPisum sativum
Primer 1A2.Forward Primer: tcaaccctaatccacaagaaga
Primer 2A2.Reverse Primer: tggaaaaagagaggcttcaata
Publication[view all]
CommentAgrogène; PSMPS prefix for marker
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerA2.Forward PrimerPisum sativumprimer
Reverse PrimerA2.Reverse PrimerPisum sativumprimer