AA102.2, AA102.2 (genetic_marker) Pisum sativum

Marker Overview
NameAA102.2
AliasAA102.2_214
Genbank IDN/A
TypeSSR
SpeciesPisum sativum
Primer 1AA102.2.Forward Primer: ctggaccaactggaagttgaag
Primer 2AA102.2.Reverse Primer: ctggaccaactggaagttgaag
Publication[view all]
CommentAgrogène; PSMPS prefix for marker
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerAA102.2.Forward PrimerPisum sativumprimer
Reverse PrimerAA102.2.Reverse PrimerPisum sativumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
AA102.2_214AA102.2_214Pisum sativummarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1pea-AlfettaxCDCBronco-RILLGIN/A6.8AA102.2_214View