AA169, AA169 (genetic_marker) Pisum sativum

Marker Overview
NameAA169
Genbank IDN/A
TypeSSR
SpeciesPisum sativum
Primer 1AA169.Forward Primer: ttgtggcgattgtaacctttga
Primer 2AA169.Reverse Primer: catttgtgcagttgcaatttcg
Publication[view all]
CommentAgrogène; PSMPS prefix for marker
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerAA169.Forward PrimerPisum sativumprimer
Reverse PrimerAA169.Reverse PrimerPisum sativumprimer