AC32, AC32 (genetic_marker) Pisum sativum | PulseDB

Marker Overview

Marker Overview


Name	AC32
Genbank ID	N/A
Type	SSR
Species	Pisum sativum
Primer 1	AC32.Forward Primer: gactattgggatttgacctgaa
Primer 2	AC32.Reverse Primer: gaaatggtccttgatcgactaa
Publication	[view all]
Comment	Agrogène; PSMPS prefix for marker

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
chr4LG4	supercontig	chr4LG4:432864416..432864657 .

Publications


Year	Publication
2005	Loridon K, McPhee K, Morin J, Dubreuil P, Pilet-Nayel ML, Aubert G, Rameau C, Baranger A, Coyne C, Lejeune-Hènaut I, Burstin J. Microsatellite marker polymorphism and mapping in pea (Pisum sativum L.). TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2005 Oct; 111(6):1022-31.