|
Marker Overview
Name | agpL2 |
Genbank ID | Y08728 |
Type | STS |
Species | Pisum sativum |
Primer 1 | agpL2.Forward Primer: CAAGTGGATACAACTGTTCTTGGT |
Primer 2 | agpL2.Reverse Primer: CTCCTATTCCTACTGGAACTCTCC |
Restriction Enzyme | RsaI |
Publication | [view all] |
References
External references for this genetic_marker
Database | Accession |
DB:genbank | Y08728 |
Publications
Year | Publication |
2005 | Timmerman-Vaughan G, Mills A, Whitfield C, Frew T, Butler R, Murray S, Lakeman M, McCallum J, Russell A, Wilson D. Linkage mapping of QTL for seed yield, yield components, and developmental traits in pea. Crop science. 2005; 45(4):1336-1344. |
|