|
Marker Overview
Name | COLc |
Genbank ID | JN982281 |
Type | HRM |
Species | Pisum sativum |
Primer 1 | COLc.Forward Primer: CACATACGGAGATAGAGACACC |
Primer 2 | COLc.Reverse Primer: TTCTCCATCGGGAACAACTC |
Publication | [view all] |
References
External references for this genetic_marker
Database | Accession |
DB:genbank | JN982281 |
Publications
Year | Publication |
2012 | Weller JL, Liew LC, Hecht VF, Rajandran V, Laurie RE, Ridge S, Wenden B, Vander Schoor JK, Jaminon O, Blassiau C, Dalmais M, Rameau C, Bendahmane A, Macknight RC, Lejeune-Hénaut I. A conserved molecular basis for photoperiod adaptation in two temperate legumes. Proceedings of the National Academy of Sciences of the United States of America. 2012 Dec 18; 109(51):21158-63. |
2014 | Duarte J, Riviere N, Barabger A, Aubert G, Burstin J, Cornet L, Lavaud C, Lejeune-Henaut I, Martinant JP, Pichon JP, Pilet-Nayel ML, Boutet G. Transcriptome sequencing for high throughput SNP development and genetic mapping in Pea. BMC Genomics. 2014; 15:126. |
|