PBA_PS_0004, PBA_PS_0004 (genetic_marker) Pisum sativum | PulseDB

Marker Overview

Marker Overview


Name	PBA_PS_0004
Genbank ID	N/A
Type	SSR
Species	Pisum sativum
Primer 1	PBA_PS_0004.Forward Primer: CCATCTCAAGCAAACAACTAC
Primer 2	PBA_PS_0004.Reverse Primer: TAATGATAAGGTGGAGGAGGT
Product Length	122
Publication	[view all]

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
Lcu.2RBY.Chr2	supercontig	Lcu.2RBY.Chr2:283056481..283056590 .

Publications


Year	Publication
2012	Kaur S, Pembleton LW, Cogan NO, Savin KW, Leonforte T, Paull J, Materne M, Forster JW. Transcriptome sequencing of field pea and faba bean for discovery and validation of SSR genetic markers. BMC genomics. 2012; 13:104.