PBA_PS_0236, PBA_PS_0236 (genetic_marker) Pisum sativum | PulseDB

Marker Overview

Marker Overview


Name	PBA_PS_0236
Genbank ID	N/A
Type	SSR
Species	Pisum sativum
Primer 1	PBA_PS_0236.Forward Primer: GACTTTGGGATATTACCTTCG
Primer 2	PBA_PS_0236.Reverse Primer: TGACTCACCTTCAATACTTGG
Product Length	133
Publication	[view all]

Alignments

The following features are aligned


Feature Name	Type	Location	Analysis	Reference
chr4LG4	supercontig	chr4LG4:445729912..445730133 .	Pisum sativum Cameor genome v1a	PCD marker alignment to genome using primer sequences

Publications


Year	Publication
2012	Kaur S, Pembleton LW, Cogan NO, Savin KW, Leonforte T, Paull J, Materne M, Forster JW. Transcriptome sequencing of field pea and faba bean for discovery and validation of SSR genetic markers. BMC genomics. 2012; 13:104.