Peachi21-1, Peachi21-1 (genetic_marker) Pisum sativum

Marker Overview
NamePeachi21-1
AliasPeachi21
Genbank IDL37876
TypeCAPS
SpeciesPisum sativum
Primer 1Peachi21-1.Forward Primer: CTTTCCCCAACTTCGCCAATAA
Primer 2Peachi21-1.Reverse Primer: TAGTCGAGAATGAAATGGTCTGAGA
Product Length876
Publication[view all]
References
External references for this genetic_marker
DatabaseAccession
DB:genbankL37876
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerPeachi21-1.Forward PrimerPisum sativumprimer
Reverse PrimerPeachi21-1.Reverse PrimerPisum sativumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
Peachi21Peachi21Pisum sativummarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1pea-JI296xDP-F2:6-RILLG3N/A0Peachi21View
2Pea-Composite_Map-RILLGIIIN/A3.8Peachi21View