PsC10309p393, PsC10309p393 (genetic_marker) Pisum sativum

Marker Overview
NamePsC10309p393
dbSNP IDN/A
TypeSNP
SNP AllelesN/A
5' Flanking SequenceTGTATGTGGCCAAGACGGACGTCGCCCATAGGCGGCCGGAGAAGGCGGTGAGTTGTTGTT
3' Flanking SequenceTTGACAAAAGGGTAATTAGGTTGCTGGGAGAAACCTTGAGAGTGGCAACCAGAACACATC
SpeciesPisum sativum
Publication[view all]
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
PsC10309p393PsC10309p393Pisum sativummarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1pea-consensusMap-2014LGVIN/A85.42PsC10309p393View
Sequence
>PsC10309p393 ID=PsC10309p393|Name=PsC10309p393|organism=Pisum sativum|type=genetic_marker|length=121bp
TGTATGTGGCCAAGACGGACGTCGCCCATAGGCGGCCGGAGAAGGCGGTG
AGTTGTTGTTRTTGACAAAAGGGTAATTAGGTTGCTGGGAGAAACCTTGA
GAGTGGCAACCAGAACACATC