sL01_910, sL01_910 (genetic_marker) Pisum sativum | PulseDB

Marker Overview

Marker Overview


Name	sL01_910
Genbank ID	N/A
Type	STS
Species	Pisum sativum
Primer 1	sL01_910.Forward primer: AATAAATATCATCACGTATCACTCACA
Primer 2	sL01_910.Reverse primer: ATGACCTTGCAAAACTTGCTAC
Product Length	890
Publication	[view all]

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
chr1LG6	supercontig	chr1LG6:335408772..335409663 .

Publications


Year	Publication
2002	Frew T, Russell A, Timmerman-Vaughan G. Sequence tagged site markers linked to the sbml gene for resistance to pea seedborne mosaic virus in pea. Plant breeding = Zeitschrift für Pflanzenzüchtung. 2002 Dec; 121(6):512-516.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	pea-JI296xDP-F2:6-RIL	LG6	N/A	24	sL01	View